circad | circRNAs associated with diseases

hsacirc_031752
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Papillary Thyroid Carcinoma (PTC)	ICD-10	Thyroid and other endocrine glands (D09.3)
DBLink		PMID	30988274
Experimental Method
Sample Type	Tissue and cell lines	Comparison	The normal human astrocyte line SVGp12 and two human glioma cell lines, U87MG and A172
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGTTTCTGCATTATTGCTCCC Reverse GGGACAGAAAGGATCCTCGG	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Yang, C, Wei, Y, Yu, L, Xiao, Y (2019). Identification of Altered Circular RNA Expression in Serum Exosomes from Patients with Papillary Thyroid Carcinoma by High-Throughput Sequencing. Med. Sci. Monit., 25:2785-2791.